90
|
STAB VIDA
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ Cyclophilin A Reverse Primer Ac C Ep Te D M An U Sc R Ip T 5’gcccgcaagtcaaagaaattagag3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm26170064-95-23-5?v=STAB+VIDA Average 90 stars, based on 1 article reviews
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system Dual Ac C Ep Te D M An U Sc R Ip T Luciferase Reporter Assay System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm23499872-85-18-26?v=Promega Average 90 stars, based on 1 article reviews
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
sc r ip t hs00300268 Sc R Ip T Hs00300268, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm29330135-76-59-71?v=Thermo+Fisher Average 86 stars, based on 1 article reviews
sc r ip t hs00300268 - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Kuang Lung Shing
scr ipt fixational eye movements Scr Ipt Fixational Eye Movements, supplied by Kuang Lung Shing, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/10__1523_slash_eneuro__0060___26__2026-216-55-60?v=Kuang+Lung+Shing Average 86 stars, based on 1 article reviews
scr ipt fixational eye movements - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
90
|
Beijing CWBio
the hcca3 protein antibody ac c ep te d m an u sc r ip t The Hcca3 Protein Antibody Ac C Ep Te D M An U Sc R Ip T, supplied by Beijing CWBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm28866087-112-12-44?v=Beijing+CWBio Average 90 stars, based on 1 article reviews
the hcca3 protein antibody ac c ep te d m an u sc r ip t - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
ac c ep te d m an u sc r ip t restriction enzymes Ac C Ep Te D M An U Sc R Ip T Restriction Enzymes, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm29037761-170-32-41?v=Promega Average 90 stars, based on 1 article reviews
ac c ep te d m an u sc r ip t restriction enzymes - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Merck & Co
sc r ip t book review merck Sc R Ip T Book Review Merck, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/10__1016_slash_j__janh__2016__01__004-7-8-14?v=Merck+%26+Co Average 86 stars, based on 1 article reviews
sc r ip t book review merck - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Finnigan Corporation
sc r ip t spectrometer Sc R Ip T Spectrometer, supplied by Finnigan Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/10__1016_slash_j__jvolgeores__2017__09__024-78-20-7?v=Finnigan+Corporation Average 86 stars, based on 1 article reviews
sc r ip t spectrometer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
86
|
Lifetech Scientific Corporation
sc r ip t culture medium Sc R Ip T Culture Medium, supplied by Lifetech Scientific Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/sc+r+ip+t/pm31398429-81-17-25?v=Lifetech+Scientific+Corporation Average 86 stars, based on 1 article reviews
sc r ip t culture medium - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |