sc r ip t Search Results


90
STAB VIDA cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’
Cyclophilin A Reverse Primer Ac C Ep Te D M An U Sc R Ip T 5’gcccgcaagtcaaagaaattagag3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm26170064-95-23-5?v=STAB+VIDA
Average 90 stars, based on 1 article reviews
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega dual- ac c ep te d m an u sc r ip t luciferase reporter assay system
Dual Ac C Ep Te D M An U Sc R Ip T Luciferase Reporter Assay System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm23499872-85-18-26?v=Promega
Average 90 stars, based on 1 article reviews
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Thermo Fisher sc r ip t hs00300268
Sc R Ip T Hs00300268, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm29330135-76-59-71?v=Thermo+Fisher
Average 86 stars, based on 1 article reviews
sc r ip t hs00300268 - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Kuang Lung Shing scr ipt fixational eye movements
Scr Ipt Fixational Eye Movements, supplied by Kuang Lung Shing, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/10__1523_slash_eneuro__0060___26__2026-216-55-60?v=Kuang+Lung+Shing
Average 86 stars, based on 1 article reviews
scr ipt fixational eye movements - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

90
Beijing CWBio the hcca3 protein antibody ac c ep te d m an u sc r ip t
The Hcca3 Protein Antibody Ac C Ep Te D M An U Sc R Ip T, supplied by Beijing CWBio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm28866087-112-12-44?v=Beijing+CWBio
Average 90 stars, based on 1 article reviews
the hcca3 protein antibody ac c ep te d m an u sc r ip t - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

90
Promega ac c ep te d m an u sc r ip t restriction enzymes
Ac C Ep Te D M An U Sc R Ip T Restriction Enzymes, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm29037761-170-32-41?v=Promega
Average 90 stars, based on 1 article reviews
ac c ep te d m an u sc r ip t restriction enzymes - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

86
Merck & Co sc r ip t book review merck
Sc R Ip T Book Review Merck, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/10__1016_slash_j__janh__2016__01__004-7-8-14?v=Merck+%26+Co
Average 86 stars, based on 1 article reviews
sc r ip t book review merck - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Finnigan Corporation sc r ip t spectrometer
Sc R Ip T Spectrometer, supplied by Finnigan Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/10__1016_slash_j__jvolgeores__2017__09__024-78-20-7?v=Finnigan+Corporation
Average 86 stars, based on 1 article reviews
sc r ip t spectrometer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Lifetech Scientific Corporation sc r ip t culture medium
Sc R Ip T Culture Medium, supplied by Lifetech Scientific Corporation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/sc+r+ip+t/pm31398429-81-17-25?v=Lifetech+Scientific+Corporation
Average 86 stars, based on 1 article reviews
sc r ip t culture medium - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results